| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.072947 |
| Chromosome: | chromosome 2 |
| Location: | 5829810 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g111050 | AMT7,AMT1G | Ammonium transporter; (1 of 8) K03320 - ammonium transporter, Amt family (amt, AMT, MEP) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAACCAGCCACTTCCCTAGTCTCGACAT |
| Internal bar code: | GCTTTAAGGGCTGACCGGTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 939 |
| LEAP-Seq percent confirming: | 99.1594 |
| LEAP-Seq n confirming: | 2949 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAACGGACAATTTGCATCT |
| Suggested primer 2: | GTAAGCTGGTGGGATCGTGT |