| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.073041 |
| Chromosome: | chromosome 9 |
| Location: | 7511192 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414000 | VTE8,HPT1 | (1 of 1) 2.5.1.116 - Homogentisate geranylgeranyltransferase / HGGT; homogentisate phytyltransferase/ prenyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCCAGCCCTTTCACTGAGAGTCTCGCGC |
| Internal bar code: | AGTTCACGCGACGTTGCAAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 211 |
| LEAP-Seq percent confirming: | 76.25 |
| LEAP-Seq n confirming: | 427 |
| LEAP-Seq n nonconfirming: | 133 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCCTCCTCATTACGAATC |
| Suggested primer 2: | CCGTACTGTTCTCGGGTCAT |