| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.073080 |
| Chromosome: | chromosome 8 |
| Location: | 4212906 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g380452 | (1 of 12) 2.7.11.22//2.7.11.23 - Cyclin-dependent kinase / Cdk-activating protein kinase // [RNA-polymerase]-subunit kinase / CTD kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAGCACTTGCAAGGGTAGGCCATCTACT |
| Internal bar code: | CTCGCAGGAACGCTCACGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 195 |
| LEAP-Seq percent confirming: | 99.8905 |
| LEAP-Seq n confirming: | 5474 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGAGGTTGACCGTGTGGT |
| Suggested primer 2: | GGGCTTGCTGTAGCTTTGTC |