| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.073142 |
| Chromosome: | chromosome 2 |
| Location: | 513648 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g076987 | (1 of 10) PTHR31867//PTHR31867:SF1 - FAMILY NOT NAMED // EXPANSIN-A1-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAACCAACGGCTGGGTCTGAACTGTGTAC |
| Internal bar code: | GGCACCGGCTTGCCGGCGCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 229 |
| LEAP-Seq percent confirming: | 97.6093 |
| LEAP-Seq n confirming: | 5471 |
| LEAP-Seq n nonconfirming: | 134 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTCTGGTGGATTCTGGTGC |
| Suggested primer 2: | ACCCCTCCTCACGTAGGTCT |