Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.073142 |
Chromosome: | chromosome 2 |
Location: | 513648 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g076987 | (1 of 10) PTHR31867//PTHR31867:SF1 - FAMILY NOT NAMED // EXPANSIN-A1-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAACCAACGGCTGGGTCTGAACTGTGTAC |
Internal bar code: | GGCACCGGCTTGCCGGCGCCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 229 |
LEAP-Seq percent confirming: | 97.6093 |
LEAP-Seq n confirming: | 5471 |
LEAP-Seq n nonconfirming: | 134 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTCTGGTGGATTCTGGTGC |
Suggested primer 2: | ACCCCTCCTCACGTAGGTCT |