Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.073247 |
Chromosome: | chromosome 1 |
Location: | 888332 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g004700 | (1 of 7) PF03188 - Eukaryotic cytochrome b561 (Cytochrom_B561) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGAGGTGACATTTGTAGTTTACTAAAAT |
Internal bar code: | CCGTCGTTCTTTCCTCTCAAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1102 |
LEAP-Seq percent confirming: | 99.027 |
LEAP-Seq n confirming: | 2239 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTCCATACCGTTGTTTCGC |
Suggested primer 2: | GGACTTTGTGTCACTCCCGT |