| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.073332 |
| Chromosome: | chromosome 3 |
| Location: | 1498416 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g151850 | (1 of 1) PF06884 - Protein of unknown function (DUF1264) (DUF1264) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCGCACCGCAGTGACGAGATGAGGCAG |
| Internal bar code: | GAGCGCGCGATCTTAGGGGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 193 |
| LEAP-Seq percent confirming: | 36.5761 |
| LEAP-Seq n confirming: | 2128 |
| LEAP-Seq n nonconfirming: | 3690 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGCACTTCACTTACGGCT |
| Suggested primer 2: | TCTGTGCTCTGCGTGGTTAC |