| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.073333 |
| Chromosome: | chromosome 10 |
| Location: | 4847758 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g454250 | FKB13,FKB16-9,FKB16I | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 2) PTHR10516:SF308 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP17-2, CHLOROPLASTIC-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTTGAAGGTCTGGCAGCGCAGCAGCGAC |
| Internal bar code: | CCAGCCGCCTTGTCAGCGTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 175 |
| LEAP-Seq percent confirming: | 70.3002 |
| LEAP-Seq n confirming: | 445 |
| LEAP-Seq n nonconfirming: | 188 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAATCACAGCCCCTCAAC |
| Suggested primer 2: | GAGTGCTTTGTCAGGGCTTC |