| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.073448 |
| Chromosome: | chromosome 2 |
| Location: | 4393174 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g099601 | (1 of 4) PF01342 - SAND domain (SAND) | CDS/5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCCTGCTCTTTGGTGCCAGCTAGCGCT |
| Internal bar code: | GATCTCTCGACAACCTAAGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 162 |
| LEAP-Seq percent confirming: | 96.1207 |
| LEAP-Seq n confirming: | 446 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCTATGCTGGCACTCAGA |
| Suggested primer 2: | GTTGCTCCTTCTCAAGCGAC |