Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.073592 |
Chromosome: | chromosome 7 |
Location: | 2146026 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g326600 | PDI6 | (1 of 4) K09584 - protein disulfide-isomerase A6 (PDIA6, TXNDC7); Protein disulfide isomerase 6 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAGGGGGAAAGGGGGATTGACATTCATG |
Internal bar code: | GTTTTTTAAGTCTCATTCAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1 |
LEAP-Seq percent confirming: | 99.5693 |
LEAP-Seq n confirming: | 1156 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGGGCTTGTTTGCACTAT |
Suggested primer 2: | ACACCACTCCACTCCTCCAC |