| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.073714 |
| Chromosome: | chromosome 15 |
| Location: | 1297271 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g641800 | RABE1,RAB8 | RAB-Like GTP binding Protein; (1 of 1) K07901 - Ras-related protein Rab-8A (RAB8A, MEL) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGTAAGCCCTAGCGCTGGGCCTCGCCCA |
| Internal bar code: | GTGCCGTCATGGCATGTCATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 304 |
| LEAP-Seq percent confirming: | 87.8821 |
| LEAP-Seq n confirming: | 6498 |
| LEAP-Seq n nonconfirming: | 896 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCAGAAGCTACAGCAGGG |
| Suggested primer 2: | CTGGTTCTGGGTCTGTGGTT |