| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.073754 |
| Chromosome: | chromosome 2 |
| Location: | 5306332 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g106750 | uS9m,MRPS9 | (1 of 2) PTHR21569//PTHR21569:SF1 - RIBOSOMAL PROTEIN S9 // 28S RIBOSOMAL PROTEIN S9, MITOCHONDRIAL; Mitochondrial ribosomal protein S9 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCATGTTCCGCCTGGACCGCACGCAGCC |
| Internal bar code: | GCACCTAGTAAGCCCGTAGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 512 |
| LEAP-Seq percent confirming: | 97.5047 |
| LEAP-Seq n confirming: | 3087 |
| LEAP-Seq n nonconfirming: | 79 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCATGAATCGCTCGTATG |
| Suggested primer 2: | CTGTCGTCGTACTTCCGTGA |