| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.073815 |
| Chromosome: | chromosome 12 |
| Location: | 5581338 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531750 | GT90-23,GT90F23 | (1 of 2) K13667 - protein glucosyltransferase (RUMI, KTELC1); GT90 family protein 23 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACCTTTACAGAACGCTGGTGGCGTACGG |
| Internal bar code: | GGGGCGGTCTTCGTCGGTCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 758 |
| LEAP-Seq percent confirming: | 99.1727 |
| LEAP-Seq n confirming: | 6353 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCACACGAACGCAGTAAT |
| Suggested primer 2: | GCATTTGGTTCGGTTCAGTT |