| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.073913 |
| Chromosome: | chromosome 10 |
| Location: | 1071160 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g425300 | (1 of 4) 6.3.5.4 - Asparagine synthase (glutamine-hydrolyzing) / Glutamine-dependent asparagine synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGGTGGGTGAATGGCAGTCATGATACCA |
| Internal bar code: | GACCAGCCCAGGGCTTTGGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 576 |
| LEAP-Seq percent confirming: | 61.5229 |
| LEAP-Seq n confirming: | 3644 |
| LEAP-Seq n nonconfirming: | 2279 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTCCTTTGCTGGAAGTG |
| Suggested primer 2: | TCTAGGACTTTCCAGCGCAT |