| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.073919 |
| Chromosome: | chromosome 9 |
| Location: | 5255460 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399663 | FXL7,FXL4 | FixL-like PAS domain protein; (1 of 11) PF13426 - PAS domain (PAS_9) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGATCGTACGTTGTCGCACTTCCCTTGC |
| Internal bar code: | AATGGAGCGCCCATTTTGTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1027 |
| LEAP-Seq percent confirming: | 90.2913 |
| LEAP-Seq n confirming: | 93 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCAGACCTATGGTGAAAA |
| Suggested primer 2: | TTGTACGCATAAGGAAGCCC |