| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.074005 |
| Chromosome: | chromosome 13 |
| Location: | 220207 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g563550 | IPP8 | (1 of 1) 3.1.3.86 - Phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase / SHIP; Inositol polyphosphate related phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAACGTGGGCAACGCACAGCCGGCCGCGG |
| Internal bar code: | CAGCTCATGGATCCGCTTAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 672 |
| LEAP-Seq percent confirming: | 83.7363 |
| LEAP-Seq n confirming: | 10112 |
| LEAP-Seq n nonconfirming: | 1964 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTTGTGGTTTTGCTGGTT |
| Suggested primer 2: | ACTGGGTGTCGCTGTCTTCT |