| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.074022 |
| Chromosome: | chromosome 9 |
| Location: | 4975458 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397956 | ELG40,FAP201 | Exostosin-like glycosyltransferase 40; (1 of 39) PTHR11062//PTHR11062:SF21 - EXOSTOSIN HEPARAN SULFATE GLYCOSYLTRANSFERASE -RELATED // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTGTCCAAATCCGCCGGTGCGGCGGCAA |
| Internal bar code: | CGTTGGTACCCGGTAGTTGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 578 |
| LEAP-Seq percent confirming: | 87.7904 |
| LEAP-Seq n confirming: | 8427 |
| LEAP-Seq n nonconfirming: | 1172 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGTGTGAGTGTGTGTGCG |
| Suggested primer 2: | CTGCTTCTACCCGAAACTCG |