| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.074030 |
| Chromosome: | chromosome 3 |
| Location: | 1103896 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g148850 | (1 of 1) 2.7.11.1//2.7.12.2 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Mitogen-activated protein kinase kinase / MKK | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCTGTGGGCCAGTAAGACCTATGGAAT |
| Internal bar code: | CCACCTGGACCAATGGCCATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 125 |
| LEAP-Seq percent confirming: | 50.5089 |
| LEAP-Seq n confirming: | 1191 |
| LEAP-Seq n nonconfirming: | 1167 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGGGTACCAGCACATTT |
| Suggested primer 2: | TCCACTGTCGCAAGTCTCAC |