| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.074080 |
| Chromosome: | chromosome 12 |
| Location: | 3341178 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g497500 | SNE7 | (1 of 8) PTHR10366:SF411 - HIGH CHLOROPHYLL FLUORESCENCE PHENOTYPE 173 PROTEIN; Cinnamoyl-CoA reductase/flavanone 4-reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGTCCCCACGGCCAACACAAGCCCCTCT |
| Internal bar code: | GTTGCCTGCGTGGAACGAACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 450 |
| LEAP-Seq percent confirming: | 96.0463 |
| LEAP-Seq n confirming: | 13021 |
| LEAP-Seq n nonconfirming: | 536 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCTTTGTATGGCAGGGTT |
| Suggested primer 2: | ATACATGGTGGCAAGCAACA |