| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.074166 |
| Chromosome: | chromosome 10 |
| Location: | 1269252 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g426950 | CYP739A3,CYP30 | (1 of 3) 1.14.13.126 - Vitamin D(3) 24-hydroxylase / CYP24A1; Cytochrome P450, CYP213 superfamily | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGGCCGCCAAGAAGTGGCTGCTCGCCAC |
| Internal bar code: | CTCCAGTCGTAAGCGGAGTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 627 |
| LEAP-Seq percent confirming: | 76.8881 |
| LEAP-Seq n confirming: | 1354 |
| LEAP-Seq n nonconfirming: | 407 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTTGGTGATACGGTCCTA |
| Suggested primer 2: | TTAGCCTACAGTTCCCGCAC |