Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.074218 |
Chromosome: | chromosome 3 |
Location: | 8257935 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g199400 | ORC2 | Origin recognition complex subunit 2; (1 of 1) K02604 - origin recognition complex subunit 2 (ORC2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACTTCCCCATCCTTCTCAGCCTGCCCTT |
Internal bar code: | CTAGTCCCTTAGAGATGCTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 16 |
LEAP-Seq percent confirming: | 99.187 |
LEAP-Seq n confirming: | 122 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTTTCATAGGCATGGTGG |
Suggested primer 2: | ACTCGGAAGAGGAGGAGGAG |