| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.074263 |
| Chromosome: | chromosome 9 |
| Location: | 3304625 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388282 | bS18m,MRPS18 | Mitochondrial ribosomal protein S18; (1 of 2) PF01084 - Ribosomal protein S18 (Ribosomal_S18) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCTTTCAGAAAGCAAACGAAAGTGTCGT |
| Internal bar code: | CAGTGGCTGTGTTACTGGGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 158 |
| LEAP-Seq percent confirming: | 92.0489 |
| LEAP-Seq n confirming: | 301 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTAACGTGCCAAACAACAA |
| Suggested primer 2: | CAACGGAATGCCCTAGTTGT |