| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.074313 |
| Chromosome: | chromosome 16 |
| Location: | 6841194 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g675413 | (1 of 68) 2.1.1.43 - Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCAGCCAGTGGCCTCCGGCAGCGAGGGC |
| Internal bar code: | GTGCCAGTTGCCCAGTATGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 414 |
| LEAP-Seq percent confirming: | 98.8048 |
| LEAP-Seq n confirming: | 1984 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTATTCCCCGTATCTTCCA |
| Suggested primer 2: | ACAACGATCAGCATGCTCTG |