| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.074319 |
| Chromosome: | chromosome 4 |
| Location: | 1943661 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g218350 | (1 of 3) IPR001383 - Ribosomal protein L28 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCAACCGGCTTTGGTGGCGCGTCTCATG |
| Internal bar code: | ACTAATAGGGCGGAAAAACGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1026 |
| LEAP-Seq percent confirming: | 99.3557 |
| LEAP-Seq n confirming: | 3547 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGTTACGGTGAGAACGAC |
| Suggested primer 2: | GGGTTCGCATGTCATTTTCT |