| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.074331 |
| Chromosome: | chromosome 4 |
| Location: | 2093167 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g219250 | IFT52,BLD1 | Intraflagellar transport protein 52; (1 of 1) PF09822 - ABC-type uncharacterized transport system (ABC_transp_aux) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGCGGGGTCCGCGCCCTGAATTTGCACT |
| Internal bar code: | TGACTCGGCGCGTAGGCCCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 340 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 468 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAAGCGAGTCTTTCCAGG |
| Suggested primer 2: | CCACTTGTCGTCAAACATGG |