| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.074374 |
| Chromosome: | chromosome 12 |
| Location: | 9155186 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g542450 | (1 of 1) K18422 - helicase MOV-10 [EC:3.6.4.13] (MOV10); ATP-dependent DNA helicase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCTCGGCCCGAGGATTACGTGCTGCTC |
| Internal bar code: | CGTGCCGCGTCCGTGCTGTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 23 |
| LEAP-Seq percent confirming: | 99.0769 |
| LEAP-Seq n confirming: | 322 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGAAGCACAACGGCAGATA |
| Suggested primer 2: | GTGTGGATGTTGCACGTCTC |