| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.074395 |
| Chromosome: | chromosome 10 |
| Location: | 191057 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g419050 | ATP1B | Mitochondrial F1F0 ATP synthase, alpha subunit; (1 of 2) PTHR15184:SF3 - ATP SYNTHASE SUBUNIT ALPHA, MITOCHONDRIAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTTGCCCCCCGGCACCACCCGCACCCCC |
| Internal bar code: | TATTTTGTGGCCACGGTGCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 218 |
| LEAP-Seq percent confirming: | 31.0709 |
| LEAP-Seq n confirming: | 618 |
| LEAP-Seq n nonconfirming: | 1371 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACATACGCATACGCAAAC |
| Suggested primer 2: | TCACAAGGAAGGGTGAGGTC |