| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.074427 |
| Chromosome: | chromosome 12 |
| Location: | 2573323 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g505350 | FAP10,ACA2 | Flagellar Associated Protein 10; (1 of 2) PTHR24093:SF254 - PLASMA MEMBRANE CALCIUM-TRANSPORTING ATPASE 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGAGCAGGTCGACAGGGTTCACGTCAAA |
| Internal bar code: | GTCTGGAGTCCGAGCTTCCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 666 |
| LEAP-Seq percent confirming: | 97.8538 |
| LEAP-Seq n confirming: | 2918 |
| LEAP-Seq n nonconfirming: | 64 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACGGACACCACAAGGATGA |
| Suggested primer 2: | GCCTGTGGTTGTTTCCTGTT |