| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.074451 |
| Chromosome: | chromosome 13 |
| Location: | 2720130 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g582270 | FFT3 | putative fructan fructosyltransferase; (1 of 1) IPR001362//IPR013148//IPR023296 - Glycoside hydrolase, family 32 // Glycosyl hydrolase family 32, N-terminal // Glycosyl hydrolase, five-bladed beta-propellor domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGTCTCCAGCCTTATCACCGGCCTCGGC |
| Internal bar code: | TGAGCCTTCCCGTCAAGCCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 90 |
| LEAP-Seq percent confirming: | 36.5986 |
| LEAP-Seq n confirming: | 269 |
| LEAP-Seq n nonconfirming: | 466 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTATCACCAGCAGCAGCAAC |
| Suggested primer 2: | CAACTCTTCGACACCTGCAA |