| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.074550 |
| Chromosome: | chromosome 12 |
| Location: | 5357562 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g529600 | RPA1 | DNA-directed RNA polymerase I subunit 1; (1 of 1) K02999 - DNA-directed RNA polymerase I subunit RPA1 (RPA1, POLR1A) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCAGATCGGCGGGCTGGCGCCCGGGCAC |
| Internal bar code: | CCCCGCAGCGCTGAACTCACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 171 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCACGGTCGTAAGGGAGTG |
| Suggested primer 2: | GCCCAACATTGAGAAGGTGT |