| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.074687 |
| Chromosome: | chromosome 12 |
| Location: | 9508306 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g541777 | CGL95 | (1 of 1) 2.1.1.259//2.1.1.43 - [Fructose-bisphosphate aldolase]-lysine N-methyltransferase / (dimerizing)]-lysine 6-N-methyltransferase // Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase; SET domain-containing protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGTACAGATGTTGGTCAAGTTGTCAGAT |
| Internal bar code: | GTGGGCCAAGTTTTCGAGCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 936 |
| LEAP-Seq percent confirming: | 99.5426 |
| LEAP-Seq n confirming: | 4570 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCTCTATTTCCAAAGCCG |
| Suggested primer 2: | ATGGCCAACCACACCTTTAG |