| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.074712 |
| Chromosome: | chromosome 4 |
| Location: | 3566020 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g228450 | CPL10 | (1 of 1) PTHR36716:SF2 - F3H9.20 PROTEIN; Conserved in the Plant Lineage | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTTCGCGCGTGCGTCTTCCAGTTGCCTT |
| Internal bar code: | TCGCTTGGTCTTGTTGTGAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 532 |
| LEAP-Seq percent confirming: | 99.7624 |
| LEAP-Seq n confirming: | 2099 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAAGCCTGCGTGTACTTG |
| Suggested primer 2: | GGGGTATATGGGGTGGGTAG |