| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.074746 |
| Chromosome: | chromosome 17 |
| Location: | 991580 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g703200 | (1 of 3) IPR001071 - Cellular retinaldehyde binding/alpha-tocopherol transport | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTGGCCCCGGCGCGGGCAGCTCCACCTC |
| Internal bar code: | GGGCGGTAAGTTCGTGGGGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 64 |
| LEAP-Seq percent confirming: | 95.4071 |
| LEAP-Seq n confirming: | 457 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGAAAGCTCCAAATTGCT |
| Suggested primer 2: | GCCCTGCACCTACATGATCT |