| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.074881 |
| Chromosome: | chromosome 3 |
| Location: | 6286251 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g193000 | HAD5 | Halo-acid dehalogenase-like hydrolase; (1 of 1) 3.1.3.29 - N-acylneuraminate-9-phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCGCCATACCCATCCGCTCAGGACGAC |
| Internal bar code: | CAAGAGTTCTCGTCCTCCCCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 92 |
| LEAP-Seq percent confirming: | 95.32 |
| LEAP-Seq n confirming: | 18005 |
| LEAP-Seq n nonconfirming: | 884 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTTTGCGCTTTGTTTTCCT |
| Suggested primer 2: | TTCATGTCAGCCACGTTCAT |