| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.074883 |
| Chromosome: | chromosome 17 |
| Location: | 4966816 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734644 | SQE1,SQE | Squalene epoxidase; (1 of 1) 1.14.13.132 - Squalene monooxygenase / Squalene epoxidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTGAATAGGGAATGCCGCGGCTGAAGTT |
| Internal bar code: | AGGCTCCGCCAGTGTATGCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 868 |
| LEAP-Seq percent confirming: | 99.4994 |
| LEAP-Seq n confirming: | 6957 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTACACCGTATCCAGCCC |
| Suggested primer 2: | ATGGGACAGTGGTAAGGCAG |