Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.074938 |
Chromosome: | chromosome 12 |
Location: | 2149285 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g508750 | LHCA2 | Light-harvesting protein of photosystem I; (1 of 24) IPR001344//IPR022796//IPR023329 - Chlorophyll A-B binding protein, plant // Chlorophyll A-B binding protein // Chlorophyll a/b binding protein domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGAACATGGTGCCATTCCCTTTCGGCTC |
Internal bar code: | CGTTCACTTCAATATGTTTCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 520 |
LEAP-Seq percent confirming: | 99.6241 |
LEAP-Seq n confirming: | 265 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCCCTGGAACAAGGTGTA |
Suggested primer 2: | TGTGATCAGCTTCCAGCAAC |