| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.075108 |
| Chromosome: | chromosome 6 |
| Location: | 3118906 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g275150 | CGL69,TGL11 | (1 of 1) PTHR21493//PTHR21493:SF84 - CGI-141-RELATED/LIPASE CONTAINING PROTEIN // F21O3.11 PROTEIN; conserved protein with lipase motif | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTCCACGGGCCAATGGTCGGATGACGC |
| Internal bar code: | GACTGATATGCTGCCGCTAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 766 |
| LEAP-Seq percent confirming: | 99.556 |
| LEAP-Seq n confirming: | 4485 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACGTTCCCTAGTTCGTGG |
| Suggested primer 2: | GTCAGGCAAGGGCAATTTTA |