| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.075223 |
| Chromosome: | chromosome 2 |
| Location: | 7126896 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g146650 | TTL3,SSA11 | (1 of 2) K16582 - tubulin polyglutamylase TTLL6/13 [EC:6.-.-.-] (TTLL6_13); Tubulin tyrosine ligase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTCTTCACTTCCCTGAGCTGTGTGTAAT |
| Internal bar code: | GTACAGTGCGGGATCACGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 238 |
| LEAP-Seq percent confirming: | 99.7553 |
| LEAP-Seq n confirming: | 1223 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTACGAAGCCTGGAGGTG |
| Suggested primer 2: | CATGTACAGCTGGTGCTGCT |