Insertion junction: LMJ.RY0402.075229_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.075229
Chromosome:chromosome_2
Location:3213272
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre02.g095072 FAP144 Flagellar Associated Protein antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):ACGTTTTGGTAGTACGCCACCGCCGTGTGC
Internal bar code:GAGAGAAGGGTATAAGGCAGAG

Confirmation - LEAP-Seq

LEAP-Seq distance:736
LEAP-Seq percent confirming:99.4649
LEAP-Seq n confirming:1487
LEAP-Seq n nonconfirming:8
LEAP-Seq n unique pos:16

Suggested primers for confirmation by PCR

Suggested primer 1:TGAGCGCTGACAATTTTACG
Suggested primer 2:CAATCGTGGTATGTTCACGC