Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.075247 |
Chromosome: | chromosome 12 |
Location: | 6394665 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g537641 | LPT1,LAT1 | (1 of 1) K13519 - lysophospholipid acyltransferase (LPT1, ALE1); Lysolipid Acyltransferase 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCCAGTTGTTGTCGGCCTGTCAGGCCTC |
Internal bar code: | AGAGGTTTGGGACGAGGGTAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 637 |
LEAP-Seq percent confirming: | 98.5736 |
LEAP-Seq n confirming: | 2557 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTAGCTTCATCAAGCCCAA |
Suggested primer 2: | ACAGCGCGTTATGAGGAGAT |