| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.075276 |
| Chromosome: | chromosome 17 |
| Location: | 1523137 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g707200 | LIC2 | (1 of 5) PF02931 - Neurotransmitter-gated ion-channel ligand binding domain (Neur_chan_LBD); Ligand-gated ion channel | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGGCATCGGCTGGCACAGGTAGGGGGGG |
| Internal bar code: | TAGGGATCGAGTGCGGATTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 435 |
| LEAP-Seq percent confirming: | 99.7152 |
| LEAP-Seq n confirming: | 23810 |
| LEAP-Seq n nonconfirming: | 68 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTTTACACGGAAGTGCGA |
| Suggested primer 2: | GCCTGTGTGTACATGCTGCT |