| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.075294 |
| Chromosome: | chromosome 9 |
| Location: | 6761279 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g409300 | (1 of 5) PF06863 - Protein of unknown function (DUF1254) (DUF1254) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGTTGATGGGCGCACTGCACGGGACAGT |
| Internal bar code: | GTGTCCACGGACACGTCGCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 651 |
| LEAP-Seq percent confirming: | 98.646 |
| LEAP-Seq n confirming: | 15882 |
| LEAP-Seq n nonconfirming: | 218 |
| LEAP-Seq n unique pos: | 99 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAAGGAAAGCACAGAACGC |
| Suggested primer 2: | CCAGCCCAAACTAAACCAAA |