| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.075329 |
| Chromosome: | chromosome 12 |
| Location: | 499335 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g493250 | FAP358 | (1 of 2) PTHR24353//PTHR24353:SF37 - CYCLIC NUCLEOTIDE-DEPENDENT PROTEIN KINASE // PROTEIN KINASE DC1-RELATED; Flagellar Associated Protein 358 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCTCTATGAGCTCGGCCTTTCACCTGCC |
| Internal bar code: | GCCCGGTGCGTCCCTGACGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 716 |
| LEAP-Seq percent confirming: | 98.9968 |
| LEAP-Seq n confirming: | 2171 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACAAAGCGCAGACAATGA |
| Suggested primer 2: | CCGTGTGCAAGGGTTATTCT |