Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.075335 |
Chromosome: | chromosome 9 |
Location: | 7799899 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g416350 | (1 of 2) K11279 - nucleosome assembly protein 1-like 1 (NAP1L1, NRP); Nucleosome assembly protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGGGCGGGTGGGGGCATGAGCGGTAGGC |
Internal bar code: | GTGCGACGTGCGTCTCCGGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 966 |
LEAP-Seq percent confirming: | 99.5487 |
LEAP-Seq n confirming: | 1103 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCACAGCTCTTGACCATTGC |
Suggested primer 2: | GTTCTGCATAAGAGGGCAGC |