| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.075336 |
| Chromosome: | chromosome 13 |
| Location: | 932661 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g568050 | SNRK2N | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase; snRK1 family in Chlamydomonas, subgroup 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGCCACACAGGACGTGCTGTGCAGTGA |
| Internal bar code: | AGGGTCGAAGAGGTCCGCCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 628 |
| LEAP-Seq percent confirming: | 98.114 |
| LEAP-Seq n confirming: | 2289 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTACCACGACAATGTCCCT |
| Suggested primer 2: | AGGCAGCCGCTAATCTGTAA |