Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.075354 |
Chromosome: | chromosome 16 |
Location: | 1044848 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g649400 | RRM15,CPLD16 | Putative RNA methyl transferase; (1 of 1) PTHR11061:SF12 - RNA BINDING PROTEIN-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTCCAACCCCCAGCCCAGCTCATGGCCC |
Internal bar code: | TGAGCGTGTCACAGTCGGGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 366 |
LEAP-Seq percent confirming: | 99.0783 |
LEAP-Seq n confirming: | 430 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTTCCTCAGGCCAACAAT |
Suggested primer 2: | TTTTTACCGATTGCACACCA |