| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.075407 |
| Chromosome: | chromosome 9 |
| Location: | 2480391 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391150 | DIV153 | (1 of 51) PF05548 - Gametolysin peptidase M11 (Peptidase_M11) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCTGTACTTCGAGCTGCGCCAGGCCGTA |
| Internal bar code: | ACCCAAGTCCCTCGCCCGTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 696 |
| LEAP-Seq percent confirming: | 96.206 |
| LEAP-Seq n confirming: | 355 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGATGGAAATCCAGGCAA |
| Suggested primer 2: | CCGATTCGTGTGGCTAGATT |