| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.075453 |
| Chromosome: | chromosome 10 |
| Location: | 2447074 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g435850 | CPLD24 | conserved expressed protein, perhaps chloroplast targetted; (1 of 23) IPR008927 - 6-phosphogluconate dehydrogenase C-terminal domain-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTTGTGCGGCGATGGGGACTTGGTCCA |
| Internal bar code: | CGGCCGCCCTTTGGGTTTCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 323 |
| LEAP-Seq percent confirming: | 99.8312 |
| LEAP-Seq n confirming: | 4140 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACGTGTGTGTGTGTGTGT |
| Suggested primer 2: | ACATACGTCAACTGGAGGGC |