| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.075521 |
| Chromosome: | chromosome 2 |
| Location: | 5259625 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g106350 | CGL68,HAP5 | (1 of 1) PTHR31446:SF5 - ACID PHOSPHATASE/VANADIUM-DEPENDENT HALOPEROXIDASE-RELATED PROTEIN; Acid phosphatase/vanadium-dependent haloperoxidase related, DUF212 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCTTCCTAGAGTGGGCCCACACTACATA |
| Internal bar code: | AGGGTGCCAAAGGCCGCATAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 313 |
| LEAP-Seq percent confirming: | 93.4049 |
| LEAP-Seq n confirming: | 609 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAAGCACAAAGCCGTGTC |
| Suggested primer 2: | AGGGACTGGACTTGGGACTT |