| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.075538 |
| Chromosome: | chromosome 6 |
| Location: | 5023316 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280250 | (1 of 1) PTHR31018:SF3 - CELL WALL MANNOPROTEIN PST1-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGGGCCTGGGATGACCCGGGCAGGCTG |
| Internal bar code: | GGCTCGCTCTCGGGGTAAGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 592 |
| LEAP-Seq percent confirming: | 99.1409 |
| LEAP-Seq n confirming: | 577 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGGACAGCTCCAAGGCAG |
| Suggested primer 2: | GAGAGGTCGCTTTGAACCAG |