| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.075548 |
| Chromosome: | chromosome 17 |
| Location: | 2809313 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g718900 | FAP88 | Flagellar Associated Protein 88; (1 of 1) PTHR23237//PTHR23237:SF6 - NUCLEOLAR PROTEIN FAMILY A MEMBER 1 SNORNP PROTEIN GAR1 // H/ACA RIBONUCLEOPROTEIN COMPLEX SUBUNIT 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATGGCCGCCTCCAGCTGGCTGAGCACCT |
| Internal bar code: | GCTATGTTTGCTCATGTCGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 299 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 672 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGCTACACCCATTTTCGG |
| Suggested primer 2: | TGCACCCATGTCTTGTTGTT |